pNtCp-rbcL-PHLS-GPPS-aadA-accD
(Plasmid #52471)

• Purpose: Inserts the beta-phellandrene synthase gene, the geranyl diphosphate synthase gene, and aadA resistance in the rbcL-accD intergenic region in Nicociana tabacum
• Depositing Lab: Anastasios Melis
• Publication: Melis lab pNtCp-rbcL-accD (unpublished)

Backbone

• Vector backbone: pBluescript II KS+
• Backbone manufacturer: Stratagene/GE Health
• Backbone size w/o insert (bp): 2886
• Total vector size (bp): 9715
• Vector type: Bacterial Expression, Synthetic Biology
• Selectable markers: Spectinomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rbcL-PHLS-GPPS-aadA-accD
• Species: Nicotiana tabacum
• Insert Size (bp): 6829

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GCCAGGGTTTTCCCAGTCACGA
• 3′ sequencing primer: GAGCGGATAACAATTTCACACAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry