Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-FLEX-rev-BFP-2a-TVA-2a-RabiesG
(Plasmid #52425)

Ordering

This material is available to academics and nonprofits only. This item is currently unavailable outside the US without additional regulatory approval. A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Item Catalog # Description Quantity Price (USD)
Plasmid 52425 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 5340
  • Total vector size (bp) 8615
  • Vector type
    AAV, Cre/Lox ; ; Adeno-Associated Virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Stbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TagBFP, TVA receptor, RabiesG
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tcacaagcgcgtttcacctcctg
  • 3′ sequencing primer gtcccgcaagccctttt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ed Callaway

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-rev-BFP-2a-TVA-2a-RabiesG was a gift from Scott Sternson (Addgene plasmid # 52425)
  • For your References section:

    Parallel, redundant circuit organization for homeostatic control of feeding behavior. Betley JN, Cao ZF, Ritola KD, Sternson SM. Cell. 2013 Dec 5;155(6):1337-50. doi: 10.1016/j.cell.2013.11.002. 10.1016/j.cell.2013.11.002 PubMed 24315102