Skip to main content
Addgene

PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PURO
(Plasmid #52419)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52419 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    addgene 26274
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERAS
  • Species
    H. sapiens (human)
  • Entrez Gene
    ERAS (a.k.a. HRAS2, HRASP)
  • Promoter CAGGS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (destroyed during cloning)
  • 3′ cloning site Not1 (destroyed during cloning)
  • 5′ sequencing primer GGGGACGGCTGCCTTCGGGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PURO was a gift from Jacob Hanna (Addgene plasmid # 52419 ; http://n2t.net/addgene:52419 ; RRID:Addgene_52419)

  • For your References section:

    Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. 10.1038/nature12745 PubMed 24172903
Related items:
Commonly requested with: