Skip to main content
Addgene

FUW-CAGGS-ERAS
(Plasmid #52416)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52416 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    FUW-CAGGS
  • Total vector size (bp) 7162
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERAS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    702
  • Entrez Gene
    ERAS (a.k.a. HRAS2, HRASP)
  • Promoter CAGGS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GGGGACGGCTGCCTTCGGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-CAGGS-ERAS was a gift from Jacob Hanna (Addgene plasmid # 52416 ; http://n2t.net/addgene:52416 ; RRID:Addgene_52416)
  • For your References section:

    Deterministic direct reprogramming of somatic cells to pluripotency. Rais Y, Zviran A, Geula S, Gafni O, Chomsky E, Viukov S, Mansour AA, Caspi I, Krupalnik V, Zerbib M, Maza I, Mor N, Baran D, Weinberger L, Jaitin DA, Lara-Astiaso D, Blecher-Gonen R, Shipony Z, Mukamel Z, Hagai T, Gilad S, Amann-Zalcenstein D, Tanay A, Amit I, Novershtern N, Hanna JH. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. 10.1038/nature12587 PubMed 24048479