Skip to main content
Addgene

pBRY-nuclear mCherry-IRES-PURO
(Plasmid #52409)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52409 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBRPy-CAGGS
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nuclear mCherry
  • Insert Size (bp)
    711

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGGGACGGCTGCCTTCGGGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBRY-nuclear mCherry-IRES-PURO was a gift from Jacob Hanna (Addgene plasmid # 52409 ; http://n2t.net/addgene:52409 ; RRID:Addgene_52409)

  • For your References section:

    Deterministic direct reprogramming of somatic cells to pluripotency. Rais Y, Zviran A, Geula S, Gafni O, Chomsky E, Viukov S, Mansour AA, Caspi I, Krupalnik V, Zerbib M, Maza I, Mor N, Baran D, Weinberger L, Jaitin DA, Lara-Astiaso D, Blecher-Gonen R, Shipony Z, Mukamel Z, Hagai T, Gilad S, Amann-Zalcenstein D, Tanay A, Amit I, Novershtern N, Hanna JH. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. 10.1038/nature12587 PubMed 24048479
Related items:
Commonly requested with: