pEGFP-Kif2A
(Plasmid #52401)

• Purpose: Expresses GFP-tagged Kif2A in mammalian cells under the CMV promoter
• Depositing Labs: Gohta Goshima, Ryota Uehara
• Publication: Uehara et al J Cell Biol. 2013 Aug 19;202(4):623-36. doi: 10.1083/jcb.201302123.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Total vector size (bp): 6849
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kif2A
• Species: H. sapiens (human)
• Insert Size (bp): 2121
• GenBank ID: NM_004520.4
• Entrez Gene: KIF2A (a.k.a. CDCBM3, HK2, KIF2)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: ATTTTATGTTTCAGGTTC

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry