Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-Kif2A
(Plasmid #52401)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52401 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Total vector size (bp) 6849
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kif2A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2121
  • GenBank ID
    NM_004520.4
  • Entrez Gene
    KIF2A (a.k.a. CDCBM3, HK2, KIF2)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer ATTTTATGTTTCAGGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-Kif2A was a gift from Gohta Goshima & Ryota Uehara (Addgene plasmid # 52401 ; http://n2t.net/addgene:52401 ; RRID:Addgene_52401)
  • For your References section:

    Aurora B and Kif2A control microtubule length for assembly of a functional central spindle during anaphase. Uehara R, Tsukada Y, Kamasaki T, Poser I, Yoda K, Gerlich DW, Goshima G. J Cell Biol. 2013 Aug 19;202(4):623-36. doi: 10.1083/jcb.201302123. 10.1083/jcb.201302123 PubMed 23960144