mouse deltaPE Oct4-GFP transgenic reporter
(Plasmid #52382)

• Purpose: BAC recombineering generated construct, used as a reporter for mouse Oct4 expression
• Depositing Lab: Jacob Hanna
• Publication: Gafni et al Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30.

Backbone

• Vector backbone: pBS KS+
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 22128
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: GFP pA
• Species: Synthetic
• Promoter: Oct4

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CTGTGTGATTCACCCTGGGG

Gene/Insert 2

• Gene/Insert name: Oct4
• Species: M. musculus (mouse)
• Insert Size (bp): 18000
• Mutation: deleted -300 - -1300bp fragment upstream from Oct4 ATG
• Entrez Gene: Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: taatacgactcactataggg

Gene/Insert 3

• Gene/Insert name: PGK-gb2-Neo
• Species: Synthetic
• Insert Size (bp): 1516
• Promoter: PGK+gb2

Cloning Information for Gene/Insert 3

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGGCTATCAGAGCAGCTTTC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct is modified pGOF18 from Young Young Il Yeom et al.,Development 122, 000-000 (1996) 881. We have introduced neo selection cassette at the 3' end of the cloned Oct4 locus.

Please note that there are several mismatches in between Addgene's quality control and the depositor's sequence. The mismatches do NOT affect plasmid function.