pTT5-hSDC1-S15/25A
(Plasmid
#52364)
-
Purposeexpresses human Syndecan-1 serine 15 and 25 mutated to alanine (numbering excludes signal peptide) in HEK293-EBNA1 (293E) suspension culture.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTT5
-
Backbone manufacturerNRC Biotechnology Research Institute
- Backbone size w/o insert (bp) 4401
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSDC1
-
Alt nameSyndecan-1 serine 15 and 25 mutated to alanine
-
SpeciesH. sapiens (human)
-
Insert Size (bp)933
-
MutationS15A, S25A and R95Q (according to numbering in Fig. 2A of associated publication)
-
Entrez GeneSDC1 (a.k.a. CD138, SDC, SYND1, syndecan)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CCATACACTTGAGTGACAATGAC
- 3′ sequencing primer TATGTCCTTCCGAGTGAGAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypTT5 backbone used in his plasmids was obtained from Yves Durocher at National Research Council of Canada (NRC)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTT5-hSDC1-S15/25A was a gift from Gordon Laurie (Addgene plasmid # 52364 ; http://n2t.net/addgene:52364 ; RRID:Addgene_52364) -
For your References section:
Targeting of heparanase-modified syndecan-1 by prosecretory mitogen lacritin requires conserved core GAGAL plus heparan and chondroitin sulfate as a novel hybrid binding site that enhances selectivity. Zhang Y, Wang N, Raab RW, McKown RL, Irwin JA, Kwon I, van Kuppevelt TH, Laurie GW. J Biol Chem. 2013 Apr 26;288(17):12090-101. doi: 10.1074/jbc.M112.422717. Epub 2013 Mar 15. 10.1074/jbc.M112.422717 PubMed 23504321