Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEL392
(Plasmid #52348)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52348 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPD95.77
  • Backbone manufacturer
    Fire lab
  • Backbone size w/o insert (bp) 4487
  • Total vector size (bp) 13418
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    fli-1
  • Alt name
    Flightless
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    8931
  • Promoter fli-1
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer CAGGAAACAGCTATGACCATG
  • 3′ sequencing primer CCTCTGACACATGCAGCTCCCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEL392 was a gift from Erik Lundquist (Addgene plasmid # 52348 ; http://n2t.net/addgene:52348 ; RRID:Addgene_52348)
  • For your References section:

    FLI-1 Flightless-1 and LET-60 Ras control germ line morphogenesis in C. elegans. Lu J, Dentler WL, Lundquist EA. BMC Dev Biol. 2008 May 16;8:54. doi: 10.1186/1471-213X-8-54. 10.1186/1471-213X-8-54 PubMed 18485202