-
PurposeIntegration cassette to create p1-Short-UL*(TGA)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepST39
- Backbone size w/o insert (bp) 5839
- Total vector size (bp) 6934
-
Vector typeBacterial Expression ; p1 Integration Vector
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameleu*
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1095
-
Mutationchanged S2F, A3V, Q180*
- Promoter UCS from pGKL2 ORF5
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgtttctattatgaatttcat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCL-GKL1ShortMutPRC-Ug1Lg2starTGA was a gift from Chang Liu (Addgene plasmid # 52347 ; http://n2t.net/addgene:52347 ; RRID:Addgene_52347) -
For your References section:
An orthogonal DNA replication system in yeast. Ravikumar A, Arrieta A, Liu CC. Nat Chem Biol. 2014 Mar;10(3):175-7. doi: 10.1038/nchembio.1439. Epub 2014 Feb 2. 10.1038/nchembio.1439 PubMed 24487693
Map uploaded by the depositor.
