Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCCL-GKL1RC-Short-LEUg1mKateg2GKL2ORF10UCS
(Plasmid #52345)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52345 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pST39
  • Backbone size w/o insert (bp) 5064
  • Total vector size (bp) 5757
  • Vector type
    Bacterial Expression ; p1 Integration Vector
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mKate2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    693
  • Mutation
    changed V2H
  • Promoter pGKL2 ORF10 UCS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ttattttttttataacttatttaa
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCCL-GKL1RC-Short-LEUg1mKateg2GKL2ORF10UCS was a gift from Chang Liu (Addgene plasmid # 52345 ; http://n2t.net/addgene:52345 ; RRID:Addgene_52345)
  • For your References section:

    An orthogonal DNA replication system in yeast. Ravikumar A, Arrieta A, Liu CC. Nat Chem Biol. 2014 Mar;10(3):175-7. doi: 10.1038/nchembio.1439. Epub 2014 Feb 2. 10.1038/nchembio.1439 PubMed 24487693