pCCL-GKL1RC-Short-LEUg1mKateg2GKL2ORF10UCS
(Plasmid
#52345)
-
PurposeIntegration cassette to create p1-Short-Leu-mKate with p2 ORF10 UCS>mKate
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepST39
- Backbone size w/o insert (bp) 5064
- Total vector size (bp) 5757
-
Vector typeBacterial Expression ; p1 Integration Vector
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemKate2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)693
-
Mutationchanged V2H
- Promoter pGKL2 ORF10 UCS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ttattttttttataacttatttaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCL-GKL1RC-Short-LEUg1mKateg2GKL2ORF10UCS was a gift from Chang Liu (Addgene plasmid # 52345 ; http://n2t.net/addgene:52345 ; RRID:Addgene_52345) -
For your References section:
An orthogonal DNA replication system in yeast. Ravikumar A, Arrieta A, Liu CC. Nat Chem Biol. 2014 Mar;10(3):175-7. doi: 10.1038/nchembio.1439. Epub 2014 Feb 2. 10.1038/nchembio.1439 PubMed 24487693