Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

cpc-PHLS (g)
(Plasmid #52311)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52311 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript KS+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2872
  • Total vector size (bp) 6429
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    beta-phellandrene synthase
  • Alt name
    PHLS
  • Species
    Lavandula angustifolia
  • Insert Size (bp)
    1623
  • GenBank ID
    HQ404305
  • Promoter Synechocystis endogenous cpc-operon promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer AGAGTCCCTGAATATCAAAA
  • 3′ sequencing primer tcaCTCATAGCGCTCAATCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Chloramphenicol resistance
  • Alt name
    cmR
  • Insert Size (bp)
    660

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGATCTGCGGCCGCgttgat
  • 3′ sequencing primer AGCTCAGTGGTGGAATTATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cpc-PHLS (g) was a gift from Anastasios Melis (Addgene plasmid # 52311 ; http://n2t.net/addgene:52311 ; RRID:Addgene_52311)
  • For your References section:

    Regulation of beta-phellandrene synthase gene expression, recombinant protein accumulation, and monoterpene hydrocarbons production in Synechocystis transformants. Formighieri C, Melis A. Planta. 2014 Aug;240(2):309-24. doi: 10.1007/s00425-014-2080-8. Epub 2014 May 20. 10.1007/s00425-014-2080-8 PubMed 24838596