psbA2(noATbox)-PHLS (c)
(Plasmid
#52308)
-
PurposeReplaces the psbA2 gene in Synechocystis with the PHLS gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52308 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript KS+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 6337
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namebeta-phellandrene synthase
-
Alt namePHLS
-
SpeciesLavandula angustifolia
-
Insert Size (bp)1623
-
MutationCAAATACA box in the psbA2 promoter to ggcgcgcc
-
GenBank IDHQ404305
- Promoter psbA2
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer AATTCAGCGTTCCAGTGGAT
- 3′ sequencing primer tcaCTCATAGCGCTCAATCA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameChloramphenicol resistance
-
Alt namecmR
-
Insert Size (bp)660
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGATCTGCGGCCGCgttgat
- 3′ sequencing primer AGCTCGATCGCCTTGGCAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psbA2(noATbox)-PHLS (c) was a gift from Anastasios Melis (Addgene plasmid # 52308 ; http://n2t.net/addgene:52308 ; RRID:Addgene_52308) -
For your References section:
Regulation of beta-phellandrene synthase gene expression, recombinant protein accumulation, and monoterpene hydrocarbons production in Synechocystis transformants. Formighieri C, Melis A. Planta. 2014 Aug;240(2):309-24. doi: 10.1007/s00425-014-2080-8. Epub 2014 May 20. 10.1007/s00425-014-2080-8 PubMed 24838596