pcDNA3-flag-YTHDF2-C
(Plasmid #52303)

• Purpose: Flag-tagged YTHDF2 C-terminal domain, from E384 to the end
• Depositing Lab: Chuan He
• Publication: Wang et al Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 6003
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: YTHDF2
• Species: H. sapiens (human)
• Insert Size (bp): 618
• Mutation: Deleted amino acids 1-383
• GenBank ID: NM_001173128
• Entrez Gene: YTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)
• Promoter: T7
• Tag / Fusion Protein:
  • flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: 5' TAATACGACTCACTATAGGG 3'
• 3′ sequencing primer: 5' ATTTAGGTGACACTATAG 3'

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry