Skip to main content
Addgene

pCAG-DN-RFX
(Plasmid #52296)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52296 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAGEN
  • Backbone size w/o insert (bp) 4798
  • Total vector size (bp) 5239
  • Modifications to backbone
    Additional restriction enzyme sites were added.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dominant negative RFX
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    423
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TGTGACCGGCGGCTCTAGAGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mouse RFX1 DNA binding domain (400-527 aa) with a C-terminal Myc tag

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-DN-RFX was a gift from Christopher A Walsh (Addgene plasmid # 52296 ; http://n2t.net/addgene:52296 ; RRID:Addgene_52296)

  • For your References section:

    Evolutionarily dynamic alternative splicing of GPR56 regulates regional cerebral cortical patterning. Bae BI, Tietjen I, Atabay KD, Evrony GD, Johnson MB, Asare E, Wang PP, Murayama AY, Im K, Lisgo SN, Overman L, Sestan N, Chang BS, Barkovich AJ, Grant PE, Topcu M, Politsky J, Okano H, Piao X, Walsh CA. Science. 2014 Feb 14;343(6172):764-8. doi: 10.1126/science.1244392. 10.1126/science.1244392 PubMed 24531968
Related items:
Commonly requested with: