pSC-hXRCC1-K176R-IntE2
(Plasmid #52277)

• Purpose: Bacterial expression of human XRCC1-K176R C-terminally fused to GyrA intein, SUMO-E2 and GST
• Depositing Lab: Primo Schaer
• Publication: Weber et al PLoS One. 2014 Jul 9;9(7):e102157. doi: 10.1371/journal.pone.0102157. eCollection 2014.

Backbone

• Vector backbone: pTXB3
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6707
• Total vector size (bp): 9543
• Modifications to backbone: CBD domain replaced by Ubc9-GST fusion resulting in the cloning vector pSC-IntE2
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: In combination with a second vector for protein expression in BL21(DE3) cells, the selection pressure was reduced by half to 50 mg/L Ampicillin
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: XRCC1
• Species: H. sapiens (human)
• Insert Size (bp): 1906
• Mutation: K176R, SUMO acceptor site mutant
• GenBank ID: NM_006297.2
• Entrez Gene: XRCC1 (a.k.a. RCC, SCAR26)
• Promoter: T7
• Tag / Fusion Protein:
  • GyrA-intein-Ubc9-GST (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Ubc9 cDNAs was amplified from pGEX-based expression vector kindly gifted by Ronald Hay

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry