-
PurposeBacterial expression of human 6His-tagged SUMO2, SUMO-E1 and SUMO-E2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52259 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDFDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3781
- Total vector size (bp) 7793
-
Modifications to backbonelinker with T7 terminator cloned into the AflII site between the two expression units of pCDFDuet1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsIn combination with a second vector for protein expression in BL21(DE3) cells, the selection pressure was reduced by half to 25 mg/L Streptomycin
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameSUMO-2
-
Alt nameSMT3H2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)330
-
MutationC-terminal gly-gly
-
GenBank IDNM_006937.3
-
Entrez GeneSUMO2 (a.k.a. HSMT3, SMT3B, SMT3H2, SUMO3, Smt3A)
- Promoter T7
-
Tag
/ Fusion Protein
- 6His-tag (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameUBE2l
-
Alt nameUbc9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)474
-
GenBank IDNM_003345.4
-
Entrez GeneUBE2I (a.k.a. C358B7.1, P18, UBC9)
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SphI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameSAE-2
-
Alt nameUBA 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1947
-
GenBank IDNM_005499.2
-
Entrez GeneUBA2 (a.k.a. ACCES, ARX, HRIHFB2115, SAE2)
- Promoter T7
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameSAE-1
-
Alt nameAos1
-
Alt nameUBLE1A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1041
-
GenBank IDNM_005500.2
-
Entrez GeneSAE1 (a.k.a. AOS1, HSPC140, SUA1, UBLE1A)
- Promoter rbs
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer GATGAGAAAGAGAATCTCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNAs of the SUMO components were amplified from pGEX-based expression vectors kindly gifted by Ronald Hay and Marc Hottiger
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUMO2 was a gift from Primo Schaer (Addgene plasmid # 52259 ; http://n2t.net/addgene:52259 ; RRID:Addgene_52259) -
For your References section:
Versatile Recombinant SUMOylation System for the Production of SUMO-Modified Protein. Weber AR, Schuermann D, Schar P. PLoS One. 2014 Jul 9;9(7):e102157. doi: 10.1371/journal.pone.0102157. eCollection 2014. 10.1371/journal.pone.0102157 PubMed 25007328