pSUMO1
(Plasmid #52258)

• Purpose: Bacterial expression of human 6His-tagged SUMO1, SUMO-E1 and SUMO-E2
• Depositing Lab: Primo Schaer
• Publication: Weber et al PLoS One. 2014 Jul 9;9(7):e102157. doi: 10.1371/journal.pone.0102157. eCollection 2014.

Backbone

• Vector backbone: pCDFDuet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 3781
• Total vector size (bp): 7815
• Modifications to backbone: linker with T7 terminator cloned into the AflII site between the two expression units of pCDFDuet1
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: In combination with a second vector for protein expression in BL21(DE3) cells, the selection pressure was reduced by half to 25 mg/L Streptomycin
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: SUMO-1
• Alt name: Ubl1
• Alt name: SMT3
• Species: H. sapiens (human)
• Insert Size (bp): 342
• Mutation: C-terminal gly-gly
• GenBank ID: NM_003352.4
• Entrez Gene: SUMO1 (a.k.a. DAP1, GMP1, OFC10, PIC1, SENP2, SMT3, SMT3C, SMT3H3, UBL1)
• Promoter: T7
• Tag / Fusion Protein:
  • 6His-tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: AGGAGATATACCATGGGCAGC

Gene/Insert 2

• Gene/Insert name: UBE2l
• Alt name: Ubc9
• Species: H. sapiens (human)
• Insert Size (bp): 474
• GenBank ID: NM_003345.4
• Entrez Gene: UBE2I (a.k.a. C358B7.1, P18, UBC9)
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SphI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: GATTATGCGG CCGTGTACAA
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Gene/Insert 3

• Gene/Insert name: SAE-2
• Alt name: UBA 2
• Insert Size (bp): 1947
• GenBank ID: NM_005499.2
• Entrez Gene: UBA2 (a.k.a. ACCES, ARX, HRIHFB2115, SAE2)
• Promoter: T7

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: TTGTACACGGCCGCATAATC

Gene/Insert 4

• Gene/Insert name: SAE-1
• Alt name: Aos1
• Alt name: UBLE1A
• Species: H. sapiens (human)
• Insert Size (bp): 1041
• GenBank ID: NM_005500.2
• Entrez Gene: SAE1 (a.k.a. AOS1, HSPC140, SUA1, UBLE1A)
• Promoter: rbs

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: NheI (destroyed during cloning)
• 5′ sequencing primer: GATGAGAAAGAGAATCTCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cDNAs of the SUMO components were amplified from pGEX-based expression vectors kindly gifted by Ronald Hay and Marc Hottiger
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry