pUC119-gRNA
(Plasmid #52255)

• Purpose: Can use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.
• Depositing Lab: Jen Sheen
• Publication: Li et al Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654.

Backbone

• Vector backbone: pUC119
• Backbone size w/o insert (bp): 3162
• Vector type: CRISPR ; Plant expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: guide RNA targeting AtPDS3
• Alt name: PDS3
• Alt name: phytoene desaturase 3
• Species: A. thaliana (mustard weed)
• GenBank ID: KF264452
• Entrez Gene: PDS3 (a.k.a. AT4G14210, DL3145C, FCAALL.28, PDE226, PDS, PHYTOENE DESATURASE, PIGMENT DEFECTIVE 226, phytoene desaturase 3)
• Promoter: Arabidopsis U6 polymerase III promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: 5’ TGGAATTGTGAGCGGATA 3’
• 3′ sequencing primer: 5’ ATTAAGTTGGGTAACGCC 3'

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

gRNA target sequence GGACTTTTGCCAGCCATGGT

This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper.