cyclin B1-CDK1 FRET biosensor
(Plasmid #52097)

• Purpose: Please note this plasmid is discontinued. If you need this plasmid for experiments, please directly contact Robert Campbell at University of Alberta.
• Depositing Lab: Robert Campbell
• Publication: Belal et al Mol Biosyst. 2014 Feb;10(2):191-5. doi: 10.1039/c3mb70402e.

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 7500
• Modifications to backbone: Kozac sequence has been added before insert gene and XhoI restriction site. The reading frame of XhoI site has also been modified.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CDK1 biosensor
• Alt name: TFP-FHA2-Substrate-YFP
• Species: Synthetic; synthetic construct
• Insert Size (bp): 1986
• GenBank ID: KF985963
• Promoter: CMV
• Tag / Fusion Protein:
  • Kozac sequence (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A FRET-based biosensors for cyclin dependent kinase 1 (CDK1) in complex with cyclin B1, with improved ratio change. It is for monitoring cyclin B1-CDK1 kinase activity in live cells. Please note that Addgene's quality control sequence shows that there is a Q to M mutation in the sensor. The mutations should not affect plasmid function.