pcDNA3.1(+)-TTF-1-HDD
(Plasmid #52063)

• Purpose: It encodes a mutant of TTF-1 in which the homeodomain is deleted
• Depositing Lab: David Mu
• Publication: Runkle et al J Biol Chem. 2012 Aug 17;287(34):28790-801. doi: 10.1074/jbc.M112.367987. Epub 2012 Jul 2.

Backbone

• Vector backbone: pcDNA3.1(+)
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Thyroid Transcription Factor 1
• Alt name: NKX2-1
• Species: H. sapiens (human)
• Insert Size (bp): 972
• Mutation: Homeodomain deleted
• Entrez Gene: NKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When compared to GenBank reference sequence NP_003308.1, amino acids 171-221 were deleted to create this mutant. See the insert sequence provided by the depositing laboratory for the mutant TTF-1 protein sequence.