paavCAG-JxON-pre-mGRASP-mCerulean
(Plasmid #51903)

• Purpose: JxOn-pre
• Depositing Lab: Jinhyun Kim
• Publication: Druckmann et al Neuron. 2014 Feb 5;81(3):629-40. doi: 10.1016/j.neuron.2013.11.026. Epub 2014 Jan 9.

Backbone

• Vector backbone: paavCAG-Jx
• Backbone size w/o insert (bp): 5000
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: presynaptic mGRASP
• Alt name: pre-mGRASP
• Species: M. musculus (mouse)
• Insert Size (bp): 1722
• GenBank ID: JN898961
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BamHI (destroyed during cloning)
• 5′ sequencing primer: gcggctctagagcctctgcta
• 3′ sequencing primer: ttaaagcagcgtatccacat

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there may be a few sequence discrepancies between Addgene's NGS results for this plasmid and the reference map provided by the depositing lab. These changes are in the backbone region outside of the viral cassette and should not affect function.