pHyVec12
(Plasmid #51851)

• Purpose: Expression in Hydra for RNAi
• Depositing Lab: Haifan Lin
• Publication: Juliano et al Proc Natl Acad Sci U S A. 2014 Jan 7;111(1):337-42. doi: 10.1073/pnas.1320965111. Epub 2013 Dec 23.

Backbone

• Vector backbone: pBlueScript II SK+
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 7193
• Vector type: RNAi ; Hydra Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: GFP hairpin
• Promoter: Actin

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: ATGAGTAAAGGAGAAGAACT
• 3′ sequencing primer: ATCAAAAATGAGGTAAAGGAGA

Gene/Insert 2

• Gene/Insert name: DsRed2
• Promoter: Actin

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: ATGGCCGATGATGAAGTTGC
• 3′ sequencing primer: CTATAAAAATAAATGATGTCTAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Robert Steele
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry