-
PurposeOptical reporter of presynaptic ATP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 8700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChimeric Synaptophysin-mCherry-Luciferase
-
Alt nameSyn-ATP
-
Alt nameTSM2
-
SpeciesR. norvegicus (rat); Photinus pyralis, Discosoma striata
-
Insert Size (bp)3300
-
MutationWithin WT luciferase gene, changed Threonine 214 to Alanine, changed Alanine 215 to Leucine, changed Isoleucine 232 to Alanine, changed Phenylalanine 295 to Leucine, changed Glutamic Acid 354 to Lysine, changed Isoleucine 423 to Leucine, and changed Aspartic Acid 436 to Glycine.
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI, XhoI (not destroyed)
- 5′ sequencing primer CACTTCTTCATAGTTGGCCGCTTGAAGTCTTTA
- 3′ sequencing primer TAAAGACTTCAAGCGGCCAACTATGAAGAAGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymutant luciferase from B.R. Branchini, U. Conn
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Syn-ATP was a gift from Timothy Ryan (Addgene plasmid # 51819 ; http://n2t.net/addgene:51819 ; RRID:Addgene_51819) -
For your References section:
Activity-driven local ATP synthesis is required for synaptic function. Rangaraju V, Calloway N, Ryan TA. Cell. 2014 Feb 13;156(4):825-35. doi: 10.1016/j.cell.2013.12.042. 10.1016/j.cell.2013.12.042 PubMed 24529383