pHCAG-L2EOP
(Plasmid #51783)

• Purpose: The oriP/EBV nuclear antigen (EBNA)-1 elements of Epstein-Barr virus is fused in frame with the luciferase in the herpes simplex virus type-1 amplicon vector, provides prolonged transgene expression
• Depositing Lab: Paula Lam
• Publication: Sia et al J Gene Med. 2010 Oct;12(10):848-58. doi: 10.1002/jgm.1506.

Backbone

• Vector backbone: pHCAG amplicon vector
• Backbone manufacturer: pHCAG generated from our laboratory
• Backbone size w/o insert (bp): 7786
• Total vector size (bp): 13120
• Modifications to backbone: Insertion of luc2EBNA-1
• Vector type: herpes simplex virus type-1 amplicon vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Luciferase-2A-EBNA-1
• Alt name: L2EOP
• Species: EBV and firefly
• Insert Size (bp): 2972
• Promoter: CAG

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: 5’ ATCATGTCTGACGAGGGCCC 3’
• 3′ sequencing primer: 5’ GCTAGCCCTTTATGTGTAACTCTT 3’

Gene/Insert 2

• Gene/Insert name: OriP
• Alt name: OriP
• Species: EBV
• Insert Size (bp): 1973

Resource Information

• Supplemental Documents:
  • Added information
• A portion of this plasmid was derived from a plasmid made by: The EBNA-1/OriP elements were synthesized using PCR from pREP7 (Invitrogen).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We would like to acknowledge, as a reference to depositing this plasmid, that the completed plasmid sequence is performed by Axil Scientific Sequencing , primer walking.

Addgene sequencing results find several discrepancies within the full plasmid sequence, they are not believed to effect the function of the plasmid.