lentiCRISPR - EGFP sgRNA 3
(Plasmid #51762)

• Purpose: Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.
• Depositing Lab: Feng Zhang
• Publication: Shalem et al Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.

Backbone

• Vector backbone: lentiCRISPR (pXPR_001), Addgene plasmid #49535
• Backbone manufacturer: Zhang lab
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: S. pyogenes CRISPR-Cas9
• Species: Synthetic
• Insert Size (bp): 4200
• Promoter: EFS

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGTACAGTGCAGGGGAAAGA
• 3′ sequencing primer: TGCCCTCCAAATATGTGAACT

Gene/Insert 2

• Gene/Insert name: Puromycin resistance
• Alt name: puromycin N-acetyl-transferase
• Alt name: PAC
• Insert Size (bp): 600
• Promoter: EFS

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: TGCTGCTACTAAGAAAGCTGGTC

Gene/Insert 3

• Gene/Insert name: EGFP sgRNA 3
• Alt name: EGFP targeting RNA element #3 (with +85 chimeric RNA)
• Species: Synthetic
• Insert Size (bp): 96
• Promoter: U6

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: #140 hU6-F

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

gRNA target sequence GGCCACAAGTTCAGCGTGTC

These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.

Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.