pSplit2-NO-PRPF6
(Plasmid #51740)

• Purpose: Express LucN-PRPF6 fusion protein in mammalian cells
• Depositing Lab: Hiroyoshi Ariga
• Publication: Maita et al Anal Biochem. 2014 Feb 3. pii: S0003-2697(14)00035-9. doi: 10.1016/j.ab.2014.01.015.

Backbone

• Vector backbone: pEXPR-IBA105
• Backbone manufacturer: iba
• Backbone size w/o insert (bp): 5531
• Total vector size (bp): 9560
• Modifications to backbone: Luciferase N-terminal fragment and FLAG tag were added to pcDNA3 before insertion of Prpf6. Prpf6 is placed behind them.Thus the order of inserted genes are Luciferase(N) -> FLAG -> Prpf6. EcoRI-SalI fragment of Prpf6 was inserted into the vector cleaved by EcoRI and XhoI, then Prpf6 cannot be recovered by enzyme digestion.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PRP6
• Species: H. sapiens (human)
• Insert Size (bp): 2800
• Entrez Gene: PRPF6 (a.k.a. ANT-1, ANT1, C20orf14, Prp6, RP60, SNRNP102, TOM, U5-102K, hPrp6)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Luciferase (1-398aa) (N terminal on backbone)
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: GAGAACCCACTGCTTACTGGC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry