SUMO-KTag
(Plasmid #51723)

• Purpose: Plasmid for recombinant expression in bacteria of SUMO domain fused to KTag, permitting covalent linkage to SpyTag
• Depositing Lab: Mark Howarth
• Publication: Fierer et al Proc Natl Acad Sci U S A. 2014 Mar 17.

Backbone

• Vector backbone: pET28a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5369
• Total vector size (bp): 5735
• Modifications to backbone: N/A
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SUMO-KTag
• Species: Synthetic
• Insert Size (bp): 366
• Mutation: none
• GenBank ID: KJ401122
• Promoter: T7
• Tag / Fusion Protein:
  • His6 Tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth

Transform plasmid into BL21(DE3)pLysS for expression.