SpyLigase
(Plasmid #51722)

• Purpose: Plasmid for recombinant expression in bacteria of SpyLigase. The Howarth lab has created two improved peptide ligation enzymes. See depositor comments below!
• Depositing Lab: Mark Howarth
• Publication: Fierer et al Proc Natl Acad Sci U S A. 2014 Mar 17.

Backbone

• Vector backbone: pDEST14
• Backbone manufacturer: Life Technologies
• Backbone size w/o insert (bp): 6400
• Total vector size (bp): 6727
• Modifications to backbone: N/A
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpyLigase
• Species: Synthetic
• Insert Size (bp): 327
• GenBank ID: KJ401122
• Promoter: T7
• Tag / Fusion Protein:
  • His6 Tag (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • Note for Cloning of SpyTag
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

SnoopLigase is the more recent peptide-peptide ligation technology from the Howarth lab and is now preferred over SpyLigase in terms of more general reaction conditions and higher coupling yield on a range of proteins.

pET28a-AviTag-SnoopLigase https://www.addgene.org/105626/
pET28a-HaloTag7-SnoopLigase https://www.addgene.org/105627/

SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth

Transform plasmid into BL21 DE3 RIPL for expression.