pT7-stl
(Plasmid #51721)

• Purpose: (Empty Backbone) conditional gene knockdowns in Trypanosoma brucei
• Depositing Lab: Arthur Gunzl
• Publication: Brandenburg et al EMBO J. 2007 Nov 28;26(23):4856-66. Epub 2007 Nov 1.

Backbone

• Vector backbone: pLEW100
• Backbone manufacturer: George Cross lab, Rockefeller University
• Modifications to backbone: The sequence of pLew100 between BsiWI and MluI restriction sites was replaced with two T7 transcription terminators and by inserting the sequence 5´-CTAATACGACTCACTATAGGGATCTCCCTA TCAGTGATAGAGATCCCTATCAGTGATAGAGA-3´, which contains the T7 promoter and two tandem tetracycline operators, in the form of two hybridized oligonucleotides into the KpnI and HindIII sites.
• Vector type: conditional gene knockdown in T. brucei
• Promoter: T7 (2X)
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: Zeo-R (ctgatgaacagggtcacgtc)
• 3′ sequencing primer: Sp6

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector contains two gene cassettes arranged head-to head. To the left, a T7 promoter (black arrow) drives the expression of the bleomycin resistance gene which is bounded by the actin A gene flanks providing splicing and polyadenylation signals (act 5' and act 3'). The downstream ribosomal sequence (rib. spacer)facilitates targeting of the construct into the transcriptionally silent spacer region of an locus.
To the right, a T7 promoter under the control of two tetracycline operators (2x Tet op.) drives the expression of a stem-loop RNA whose coding region can be introduced into pT7-stl analogously to the established stem-loop cloning strategy (Shi, et al, 2000). The stem-loop RNA coding region is followed by two T7 transcription terminators (T7 trm.) and an aldolase gene 3' flank (ald 3').