DRH322: AAV-CaMKIIa-QuasAr2-mO2
(Plasmid #51696)

• Purpose: AAV production of QuasAr2 fluorescent reporter
• Depositing Lab: Adam Cohen
• Publication: Hochbaum et al Nat Methods. 2014 Aug;11(8):825-33. doi: 10.1038/nmeth.3000. Epub 2014 Jun 22.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5358
• Total vector size (bp): 6915
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: QuasAr2-mOrange
• Species: Synthetic
• Insert Size (bp): 1556
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • mOrange2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCTCGTCAATCAAGCTGGTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry