DRH335: FCK-Optopatch1
(Plasmid #51695)

• Purpose: Coexpression plasmid of QuasAr1 and CheRiff for all-optical electrophysiology
• Depositing Lab: Adam Cohen
• Publication: Hochbaum et al Nat Methods. 2014 Aug;11(8):825-33. doi: 10.1038/nmeth.3000. Epub 2014 Jun 22.

Backbone

• Vector backbone: FCK(1.3)
• Backbone manufacturer: Pavel Osten
• Backbone size w/o insert (bp): 9236
• Total vector size (bp): 12590
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Optopatch1
• Species: Synthetic
• Insert Size (bp): 3354
• Promoter: CaMKIIa

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: gcctctttgccccacttaat
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry