HO-pMET-poly-KanMX4-HO
(Plasmid
#51665)
-
Purpose(Empty Backbone) yeast plasmid for integration of target sequence at HO locus, Kan selection, pMET inducible promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneHO-Poly-HO
-
Backbone manufacturerStillman Lab, Addgene plasmid # 51661
-
Vector typeYeast Expression ; yeast integration
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pHIS-F (in MET17 promoter), TCGTGTAATACAGGGTCGTCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HO-pMET-poly-KanMX4-HO was a gift from David Stillman (Addgene plasmid # 51665 ; http://n2t.net/addgene:51665 ; RRID:Addgene_51665) -
For your References section:
Yeast vectors for integration at the HO locus. Voth WP, Richards JD, Shaw JM, Stillman DJ. Nucleic Acids Res. 2001 Jun 15;29(12):E59-9. 10.1093/nar/29.12.e59 PubMed 11410682
Map uploaded by the depositor.
