-
Purposehsyn promoting optopatch, which includes a ChR64, GFP, Quasar2 and mOrange
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentivirus backbone
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQuasar2-mOrange-Chr64-GFP
-
Alt nameArch3.77H97Q
-
SpeciesSynthetic
-
Insert Size (bp)3349
- Promoter human synapsin
-
Tags
/ Fusion Proteins
- mOrange
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGTCGTGTCGTGCCTGAGAG
- 3′ sequencing primer GCAGCGTATCCACATAGCGTAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Optopatch2 (QuasAr2-mOrange2-P2A-CheRiff-eGFP) was a gift from Adam Cohen (Addgene plasmid # 51656 ; http://n2t.net/addgene:51656 ; RRID:Addgene_51656)