FRIG-myc-Sema4DdeltaC
(Plasmid
#51607)
-
Purposeexpresses myc-tagged Sema4D lacking C terminus in lentiviral backbone
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFRIG
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 9300
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSema4DdeltaC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2300
-
Mutationdeleted last 70 amino acids in the C-terminus
-
GenBank IDNM_001281880
-
Entrez GeneSema4d (a.k.a. CD100, Semacl2, Semaj, Semcl2, coll-4)
- Promoter RSV
-
Tag
/ Fusion Protein
- myc tag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGTCAAGTTCAGGTGGTCACAGG
- 3′ sequencing primer TACAACTGCTACAAGGGCTAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FRIG-myc-Sema4DdeltaC was a gift from Suzanne Paradis (Addgene plasmid # 51607 ; http://n2t.net/addgene:51607 ; RRID:Addgene_51607) -
For your References section:
Sema4D localizes to synapses and regulates GABAergic synapse development as a membrane-bound molecule in the mammalian hippocampus. Raissi AJ, Staudenmaier EK, David S, Hu L, Paradis S. Mol Cell Neurosci. 2013 Nov;57:23-32. doi: 10.1016/j.mcn.2013.08.004. Epub 2013 Sep 10. 10.1016/j.mcn.2013.08.004 PubMed 24036351