Skip to main content
Addgene

pCMV-myc-Sema4DdeltaC
(Plasmid #51602)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51602 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 6300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sema4DdeltaC
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2300
  • Mutation
    Last 69 amino acids of Sema4D C-terminus are deleted.Silent mutations between amino acids (approx 275-281) to make resistant against shRNA1. Also silent mutation at aa 54-60 to make susceptible to shRNA2.
  • GenBank ID
    NM_001281880
  • Entrez Gene
    Sema4d (a.k.a. CD100, Semacl2, Semaj, Semcl2, coll-4)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TGTCAAGTTCAGGTGGTCACAGG
  • 3′ sequencing primer TACAACTGCTACAAGGGCTAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.

The Sema4D insert in this plasmid does not contain amino acids 1-50 and contains a L745P mutation when compared to GenBank reference sequence NP_542764.2

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-myc-Sema4DdeltaC was a gift from Suzanne Paradis (Addgene plasmid # 51602 ; http://n2t.net/addgene:51602 ; RRID:Addgene_51602)
  • For your References section:

    Sema4D localizes to synapses and regulates GABAergic synapse development as a membrane-bound molecule in the mammalian hippocampus. Raissi AJ, Staudenmaier EK, David S, Hu L, Paradis S. Mol Cell Neurosci. 2013 Nov;57:23-32. doi: 10.1016/j.mcn.2013.08.004. Epub 2013 Sep 10. 10.1016/j.mcn.2013.08.004 PubMed 24036351