Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-myc-Rem2 S308A
(Plasmid #51592)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51592 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rem2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1000
  • Mutation
    Serine 308 to Alanine; also RNAi resistant
  • Entrez Gene
    Rem2 (a.k.a. AW411893)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
  • 3′ sequencing primer CATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.

The Rem2 insert in this plasmid contains T13I and T15I mutations when compared to GenBank reference sequence NP_542764.2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-myc-Rem2 S308A was a gift from Suzanne Paradis (Addgene plasmid # 51592 ; http://n2t.net/addgene:51592 ; RRID:Addgene_51592)
  • For your References section:

    CaMKII-dependent phosphorylation of the GTPase Rem2 is required to restrict dendritic complexity. Ghiretti AE, Kenny K, Marr MT 2nd, Paradis S. J Neurosci. 2013 Apr 10;33(15):6504-15. doi: 10.1523/JNEUROSCI.3861-12.2013. 10.1523/JNEUROSCI.3861-12.2013 PubMed 23575848