pCMV-myc-Rem2 S129N
(Plasmid #51587)

• Purpose: expresses RNAiR myc-tagged Rem2 non-GTP binding
• Depositing Lab: Suzanne Paradis
• Publication: Ghiretti et al Dev Neurobiol. 2011 May;71(5):374-89. doi: 10.1002/dneu.20868.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rem2
• Species: M. musculus (mouse)
• Insert Size (bp): 1000
• Mutation: S129N; silent mutations at shRNA 1 and 2 recognition sites (approx. AA 143-160)
• Entrez Gene: Rem2 (a.k.a. AW411893)
• Promoter: CMV
• Tag / Fusion Protein:
  • myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: GATCCGGTACTAGAGGAACTGAAAAAC
• 3′ sequencing primer: CATTCTAGTTGTGGTTTGTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.

The Rem2 insert in this plasmid contains T13I and T15I mutations when compared to GenBank reference sequence NP_542764.2.