Lyr_M37_KDEL
(Plasmid #51530)

• Purpose: Ectopic expression of Lyr with KDEL tag for CTAP
• Depositing Lab: Claus Jorgensen
• Publication: Tape et al Mol Cell Proteomics. 2014 May 12.

Backbone

• Vector backbone: pCDNA3.1 (+) Zeo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 6200
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Lysine Racemase
• Alt name: Lyr
• Species: P. mirabilis
• Insert Size (bp): 1200
• Mutation: aa's 1-36 removed
• Promoter: CMV
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • KDEL (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGACTCACTATAGGGAGACCCAAGC
• 3′ sequencing primer: CCTTCCAGGGTCAAGGAAGGCACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GeneArt
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Amino acids 1-36 were removed and a KDEL tag was added to limit extracellular localization. Please see the associated article for more information.

Note that the sequence here matches some putative database entries for alanine racemase, but the protein has been functionally characterised as lysine racemase