Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

DDC_M_Tub_KDEL
(Plasmid #51529)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51529 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA3.1 (+) Zeo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DDC
  • Alt name
    Diaminopimelate Decarboxylase
  • Species
    Mycobacterium tuberculosis
  • Insert Size (bp)
    1500
  • Promoter CMV
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • KDEL (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGACTCACTATAGGGAGACCCAAGC
  • 3′ sequencing primer CCTTCCAGGGTCAAGGAAGGCACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GeneArt
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DDC_M_Tub_KDEL was a gift from Claus Jorgensen (Addgene plasmid # 51529 ; http://n2t.net/addgene:51529 ; RRID:Addgene_51529)
  • For your References section:

    Cell-specific labeling enzymes for analysis of cell-cell communication in continuous co-culture. Tape CJ, Norrie IC, Worboys JD, Lim L, Lauffenburger DA, Jorgensen C. Mol Cell Proteomics. 2014 May 12. 10.1074/mcp.O113.037119 PubMed 24820872