pNJB99
(Plasmid #51521)

• Purpose: Gateway entry vector with attL1 and attR5 sites flanking Zif268:FokI coding sequence
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pNJB91
• Backbone size w/o insert (bp): 4659
• Total vector size (bp): 4033
• Vector type: Gateway entry vector

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Zif268:FokI
• Species: fusion between human and bacterial genes
• Insert Size (bp): 897
• Tag / Fusion Protein:
  • NLS (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: AttII (not destroyed)
• 5′ sequencing primer: atggcttcctcccctccaaa
• 3′ sequencing primer: attgatcccccctcgacagct

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Zif268:FokI was PCR amplified from pDW1345 and cloned into pNJB91.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry