pNJB80
(Plasmid #51518)

• Purpose: (Empty Backbone) Gateway entry vector with attL5 and attL2 sites flanking a CmR and ccdB gene. In our hands, the multisite reaction still proceeds efficiently.
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCR8
• Backbone size (bp): 4000
• Modifications to backbone: AttL1 site was replaced with AttL5 site and Chloramphenicol and ccdB genes were cloned in between the Att sites.
• Vector type: Gateway entry vector

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: gaggatccggcttactaaaag
• 3′ sequencing primer: agtgatttttttctccatttt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: A long oligo containing the attL5 sequence was ordered from Invitrogen. The sequence was fused to the ccdB Chloramphenicol sequence obtained from pFZ19 by PCR amplification.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A single nucleotide from the attL5 sequence is missing (an extra A should be at the 5' end of attL5).