p35SZ
(Plasmid #51513)

• Purpose: pMDC32 with Zif268:FokI followed by approximately 3kb of filler sequence
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pMDC32
• Backbone size w/o insert (bp): 11752
• Total vector size (bp): 14248
• Vector type: plant expression T-DNA
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Zif268:FokI
• Species: fusion between human and bacterial genes
• Insert Size (bp): 897
• Promoter: 2x35S
• Tag / Fusion Protein:
  • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: atggcttcctcccctccaaag
• 3′ sequencing primer: ctattaaaagtttatctcacc

Gene/Insert 2

• Gene/Insert name: 3kb filler sequence
• Alt name: ALS repair template
• Species: N. tabacum
• Insert Size (bp): 3000

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: tgcgagatcgggccggcctggc
• 3′ sequencing primer: gatattttgaattaaagataac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Zif268:FokI and the 3 kb filler sequence were PCR amplified from pDW1345 and pZHY455. Zif268 was cloned into pNJB91 and the 3 kb filler sequence was cloned into pNJB80. pNJB80 and pNJB91 were used in a multi-site Gateway reaction with pMDC32.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.