p35SZ.D
(Plasmid #51512)

• Purpose: pMDC32 with Zif268:FokI followed by us:NPTII repair template sequence
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pMDC32
• Backbone size w/o insert (bp): 11752
• Total vector size (bp): 13973
• Vector type: plant expression T-DNA
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Zif268:FokI
• Species: fusion between human and bacterial genes
• Insert Size (bp): 897
• Promoter: 2x35S
• Tag / Fusion Protein:
  • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: atggcttcctcccctccaaaga
• 3′ sequencing primer: ctattaaaagtttatctcaccg

Gene/Insert 2

• Gene/Insert name: us:NPTII repair template
• Insert Size (bp): 2600

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: agcagtcttacttccatgatttc
• 3′ sequencing primer: tcagaagaactcgtcaagaa

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Zif268:FokI was amplified by PCR using pDW1345 as a template. This sequence was cloned into pNJB91. us:nptII repair template was amplified by PCR using pDW1269 as a template. This sequence was cloned into pNJB80. pNJB80 and pNJB91 with these two inserts were used in a multi-site Gateway reaction with pMDC32.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry