pZLSLD.R
(Plasmid #51511)

• Purpose: Single component LSL vector. Contains 2x35S:Zif268:FokI outside of the replicon borders. Within the replicon is the us:NPTII template.
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size w/o insert (bp): 10531
• Total vector size (bp): 15215
• Modifications to backbone: cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-Rep/RepA-LIR orientation.
• Vector type: plant T-DNA plasmid
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Zif268:FokI
• Species: fusion between human and bacterial genes
• Insert Size (bp): 897
• Promoter: 2x35S
• Tag / Fusion Protein:
  • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ATGGCTTCCTCCCCTCCAA
• 3′ sequencing primer: CTATTAAAAGTTTATCTCACCG

Gene/Insert 2

• Gene/Insert name: us:NPTII repair template
• Insert Size (bp): 2600

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: agcagtcttacttccatgattt
• 3′ sequencing primer: tcagaagaactcgtcaagaag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Zif268:FokI and us:nptII repair template sequence were amplified by PCR using p35SZ.D as a template.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry