pLSLGFP.R
(Plasmid #51501)

• Purpose: Single component LSL vector with GFP. Rep is expressed from the complementary sense LIR promoter. GFP is between LIR and SIR and is driven from a 2X35S promoter. Rep is within the replicon
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size w/o insert (bp): 10531
• Total vector size (bp): 12417
• Vector type: plant T-DNA plasmid
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP
• Species: jellyfish
• Insert Size (bp): 900
• Promoter: 2x35S

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmlI (destroyed during cloning)
• 3′ cloning site: PmlI (destroyed during cloning)
• 5′ sequencing primer: atggtgagtaaaggagaaga
• 3′ sequencing primer: ttatttgtatagttcatccatg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GFP was amplified by PCR using pTC23 as a template.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.