pLSLR
(Plasmid #51500)

• Purpose: (Empty Backbone) Single component plant T-DNA plasmid. Contains cis- and trans-acting replicational elements from the bean yellow dwarf virus in an LIR-SIR-Rep/RepA-LIR orientation.
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size (bp): 10531
• Modifications to backbone: cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-Rep/RepA-LIR orientation.
• Vector type: plant T-DNA plasmid
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: tcccactgacttgaagtacac
• 3′ sequencing primer: ggacttgtttagagtttcta

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cis-acting elements were amplified from pLSL. The Rep/RepA coding sequence was amplified from pREP.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Due to the repeat regions in this plasmid, Addgene was unable to obtain very much sequence for quality control purposes. The depositing lab recommends performing a diagnostic digest before using.