pLSLT
(Plasmid #51498)

• Purpose: pLSL with T30 TALEN followed by us:NPTII repair template, Rep is not included on this plasmid
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size w/o insert (bp): 12921
• Total vector size (bp): 20743
• Modifications to backbone: cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
• Vector type: plant T-DNA plasmid
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: T30 TALEN pair
• Species: Xanthomonas
• Insert Size (bp): 6600
• Promoter: virion-sense LIR and 2x35S

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: tcattgtctttgttgtgtatt
• 3′ sequencing primer: atcaattcccgatctagtaac

Gene/Insert 2

• Gene/Insert name: us:NPTII repair template
• Insert Size (bp): 2600

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gtcttacttccatgatttct
• 3′ sequencing primer: tcagaagaactcgtcaagaa

Resource Information

• A portion of this plasmid was derived from a plasmid made by: T30 TALEN pair was obtained by digesting pZHY528 with restriction enzymes to release the two TALENs. us:NPTII repair template was PCR amplified pDW1269.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Cellectis Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that Addgene was unable to sequence the RVD region of this plasmid due the repetitive nature of the sequence around it.