pLSLZ.D
(Plasmid #51496)

• Purpose: pLSL with Zif268:FokI coding sequence followed by us:NPTII repair template , Rep is not included on this plasmid
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size w/o insert (bp): 12921
• Total vector size (bp): 15142
• Modifications to backbone: cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
• Vector type: plant T-DNA plasmid
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Zif268:FokI
• Species: fusion between human and bacterial genes
• Insert Size (bp): 897
• Promoter: virion-sense LIR and 2x35S
• Tag / Fusion Protein:
  • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: atggcttcctcccctccaaag
• 3′ sequencing primer: agctgtcgaggggggatcaat

Gene/Insert 2

• Gene/Insert name: us:NPTII repair template
• Insert Size (bp): 2600

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: agcagtcttacttccatgatt
• 3′ sequencing primer: tcagaagaactcgtcaagaaggcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Zif268:FokI was amplified by PCR using pDW1345 as a template. us:NPTII repair template was amplified by PCR using pDW1269 as a template.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.