Skip to main content
Addgene

pLSLZ.D
(Plasmid #51496)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51496 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAMBIA1300
  • Backbone size w/o insert (bp) 12921
  • Total vector size (bp) 15142
  • Modifications to backbone
    cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
  • Vector type
    plant T-DNA plasmid
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Zif268:FokI
  • Species
    fusion between human and bacterial genes
  • Insert Size (bp)
    897
  • Promoter virion-sense LIR and 2x35S
  • Tag / Fusion Protein
    • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atggcttcctcccctccaaag
  • 3′ sequencing primer agctgtcgaggggggatcaat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    us:NPTII repair template
  • Insert Size (bp)
    2600

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer agcagtcttacttccatgatt
  • 3′ sequencing primer tcagaagaactcgtcaagaaggcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Zif268:FokI was amplified by PCR using pDW1345 as a template. us:NPTII repair template was amplified by PCR using pDW1269 as a template.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSLZ.D was a gift from Daniel Voytas (Addgene plasmid # 51496 ; http://n2t.net/addgene:51496 ; RRID:Addgene_51496)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519