pLSLZ
(Plasmid #51495)

• Purpose: pLSL with Zif268:FokI coding sequence followed by approximately 3kb 'filler' sequence, Rep is not included on this plasmid
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pCAMBIA1300
• Backbone size w/o insert (bp): 12921
• Total vector size (bp): 15619
• Modifications to backbone: cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
• Vector type: plant T-DNA plasmid
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Zif268:FokI
• Species: fusion between human and bacterial genes
• Insert Size (bp): 897
• Promoter: virion-sense LIR and 2x35S
• Tag / Fusion Protein:
  • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: atggcttcctcccctccaaag
• 3′ sequencing primer: agctgtcgaggggggatcaa

Gene/Insert 2

• Gene/Insert name: 3kb filler sequence
• Alt name: ALS repair template
• Species: N. tabacum
• Insert Size (bp): 3000

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: tgcgagatcgggccggcctg
• 3′ sequencing primer: gatattttgaattaaagata

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The Zif268:FokI sequence was amplified by PCR using pDW1345. The 3 kb filler sequence was amplified using pZHY455.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry